Prevalence and Molecular Characterization of Anaplasma marginale in Cattle Population
of Khyber Pakhtunkhwa Province, Pakistan
Muhammad Shoaib1, Muhammad Imran Rashid1*,
Haroon Akbar1, Ali Ahmad Sheikh2, Shahid Hussain Farooqi3,
Mumtaz Ali Khan4, Farhan Anwar Khan5 and Rajwali Khan6
1Department of Parasitology, University of Veterinary and
Animal Sciences, Lahore, Pakistan
2Department of Microbiology, University of Veterinary and
Animal Sciences, Lahore, Pakistan
3Department of Clinical Sciences, KBCMA, College of
Veterinary and Animal Sciences, Narowal, Pakistan
4Livestock and Dairy Development (Extension), (KP),
Pakistan
5College of Veterinary sciences, The University of
Agriculture, Peshawar, Khyber Pakhtunkhwa (KP), Pakistan
6Department of Livestock Management, Breeding and Genetics,
The University of Agriculture Peshawar, Khyber Pakhtunkhwa (KP), Pakistan
*For correspondence: imran.rashid@uvas.edu.pk
Received 21 November 2020; Accepted 28 January 20201; Published 16 April
2021
Abstract
Anaplasmosis is a hemo-rickettsial disease of cattle and
is most prevalent in tropical and subtropical regions of the world including
Pakistan. This disease has been placed as one of the most economically
important haemoparasitic diseases. The aim of the current study was to
determine the molecular characterization and to assess the prevalence of Anaplasma marginale (A. marginale)
infection in cattle and associated risk factors in three districts of Khyber
Pakhtunkhwa (KP) province of Pakistan viz.,
Mardan, Kohat and Swat. The blood samples were collected conveniently from 434
tick-infested animals keeping the aseptic measures. A. marginale was identified from blood samples by microscopy and
PCR. Sequencing and phylogenetic analysis
of the sequenced isolates of this study showed close sequence similarity with
the reported strains of USA, Thailand, Uganda, Uruguay, Zimbabwe, Philippines and China. Moreover, multiple sequence alignment of
the 16S ribosomal RNA gene sequences of 5
different clones of the A. marginale depicts substantial variation in
the genotypes of A. marginale found in different locations of KP. The
prevalence of A. marginale infection
was non-significantly associated (P > 0.05) with districts,
season, breed, age and sex of cattle. The
highest prevalence of A. marginale
infection was recorded in district Swat (20.30%) followed by Kohat (16.81%) and Mardan (15.00%) districts of KP. The
prevalence of infection was highest in exotic breeds and their crosses, adults and
female cattle. 10.70, 16.11, 46.70 and 26.70%
were the prevalence of infection recorded for winter, spring, summer and autumn
season, respectively. This study concludes that A. marginale infection is dominant in district Swat followed by Kohat and Mardan districts of KP
province of Pakistan, respectively. © 2021 Friends Science Publishers
Key words: Prevalence;
Anaplasmosis; Cattle; Sequencing; Phylogeny; Risk factors
Introduction
Anaplasma belongs to
the rickettsial group of parasites which is an intraerythrocytic obligate
bacteria responsible for bovine anaplasmosis and is transmitted by ticks (Inokuma 2007). Important species of the genus
Anaplasma include Anaplasma centrale, A. marginale, A. phagocytophilum, A. ovis, A. platys and A. bovis. A. bovis is found both in wild and domestic animals in
different parts of the world (Liu et al.
2012). A. centrale and A. marginale
cause bovine anaplasmosis (Minjauw and McLeod 2003; Kocan et al. 2004). Gall sickness is
another name of the disease. Almost all domesticated animals like buffaloes,
cattle, goats, sheep as well as wild ruminants are affected by this disease. Bovine
anaplasmosis is most commonly caused by A.
marginale. It is a highly pathogenic disease characterized by weakness,
anorexia, weight loss, depression, fever, jaundice, hemolytic anemia, decreased
milk production, abortion and death. Cattle are more susceptible to infection
than buffaloes and the disease causes high mortality in livestock (Rajput et al.
2005; Kocan et al. 2010). Transmission of the
disease occurs mostly by ticks, about 20 ticks species are involved in the
transmission of the disease (Marchette and Stiller 2018). Notable ticks species
are Hyalomma species, Rhipicephalus species, Ixodes species, Boophilus species and Dermacentor
species (Jongejan and Uilenberg 2004). Anaplasmosis occurs mainly in
hot, humid and rainy seasons due to an abundance of ticks (El-Metenawy 2000). Surgical blades and contaminated
needles are the mechanical sources of transmission of the disease. It is
estimated that globally tick-borne diseases produce losses ranging from 13.9–18.7
billion US$ per year affecting 80% population of cattle (Ghosh et al. 2007). Anaplasmosis is one of the
global importance diseases and is prevalent in developing countries like Zambia
where livestock faces some serious challenges from tick-borne diseases
especially anaplasmosis (Makala et al. 2003; Minjauw and McLeod 2003). Bovine anaplasmosis
is highly prevalent in Africa and Asia due to the vast tick’s movement and
global warming (Jonsson and Reid 2000).
Anaplasmosis is a hemo-rickettsial disease of cattle and
is highly prevalent in tropical and subtropical regions of the world including
Pakistan (Dumler et al. 2001; Atif et al.
2013; Iqbal et al. 2019). It is
one of the most prevalent hemoparasitic infections in Pakistan affecting
bovines and its prevalence is 4–75.5% (Khan et
al. 2004). It is a major health issue for livestock and cattle population
in particular in Khyber Pakhtunkhwa (Nieto et al. 2012; Nasreen et al. 2016; Shah et al. 2017; Farooqi et al.
2018; Khan et al. 2019; Turi et al. 2019). This project aimed
to find out the prevalence, molecular diagnosis, and characterization of A. marginale in the KP province of
Pakistan.
Materials and Methods
Study area
This study was carried out from January
2018 to March 2019. The blood samples were collected from different cattle
breeds of three districts of KP province viz.,
Mardan, Kohat and Swat as shown by Fig.
1. 434 blood samples were collected by the convenient
method of sampling (Fanzana and Srunvet al. 2001). A total of 160, 131 and 143 blood samples were collected from Mardan,
Kohat and Swat districts, respectively. A pre-tested data collection
form was used having information about the data regarding date of sample
collection, details about the animal (age, breed and sex) and place of the
collection (Thrusfield 2007). About 5 mL of
blood was collected from the jugular vein of cattle into vacutainers containing EDTA as an anticoagulant for the
preservation of blood samples. Then these samples were shifted to
parasitology laboratory UVAS, Lahore and were stored at −20ºC. GPS data was processed in MS Excel and then imported
into ArcGIS 10.2. The sampling sites were geo-visualized in the form of point
map. Then same points were populated on the map of Pakistan to present the
spatial distribution of samples.
Microscopic
examination
Thin smears were prepared on the spot
for better results. The smears were fixed with absolute ethanol and stained
with Giemsa in the laboratory of Parasitology, University of Veterinary and
Animal Sciences Lahore. The smears were examined at 100x magnification under a
compound microscope for the presence of A.
marginale (Kumar et al. 2015).
Molecular examination
Molecular identification of A. marginale was carried out through polymerase chain reaction (Roy et al. 2018). The DNA was extracted by
using a DNA extraction kit (cat. No: FABGK001-2) by the method used by (d'Oliveira
et al. 1995). The purity and
concentration of extracted DNA were checked by Nanodrop and was stored at
−20ºC. The Polymerase chain reaction (PCR) was performed as described by
(Gubbels et al. 1999). The extracted
DNA samples were subjected to PCR which amplified the 16S rRNA gene of Anaplasma by
using general primer EHR. This general primer consists of a forward primer EHR-16SD (5’-
GGTACCTACAGAAGAAGTCC–3’) and a reverse primer EHR-16SR (5’-
TAGCACTCATCGTTTACAGC–3’) and this set of primers targeted the 16S ribosomal RNA
gene of Anaplasma
(Tay et al.
2014). Master mix solution for PCR
was prepared, 20 µL reaction mixture
having 1.5 U of Taq DNA polymerase was taken and 2 µL of extracted DNA, 25 pmol of each primer, 200 mM of each dNTP, 5 µL of 10X PCR buffer and 1.5 mM
MgCl2 (Promega, Madison, W.I., U.S.A.) were added. An initial
denaturation step was the first step of the PCR reaction cycle which was set at
94ºC for 5 min followed by a second cycle of denaturation (40 cycles) at 94ºC for 30 s, then
annealing for 30 s at 55ºC and then extension for one min at 72ºC. The final
extension was done for 5 min at 72ºC which was followed by a hold step at 4ºC. In each PCR experiment, a control positive
(Agricultural Research Service, Animal Disease Research Unit, Department of
Agriculture, Pullman, W.A., U.S.A.) and control negative were included. Gel
electrophoresis was used for checking of positive bands against a standard
molecular ladder of 100 bp on ethidium bromide stained 1.5% agarose gel at 200
amperes, 120 V for 30 min (Fig. 3). The bands for A. marginale were observed at 345 bp level. The positive bands were
then cut and were considered for sequencing for further confirmation.
Sequencing
The PCR bands of haemoparasites were cut on 1.5% agarose
gel using a cutter. The gel extraction kit (WizPrepTM Gel/PCR
purification kit, Ref. W70150-300) was then used for the extraction and
purification of DNA bands from gel following the directions of the
manufacturer. By using gel electrophoresis DNA concentration was checked and
the DNA samples were sent to 1st base DNA sequencing services,
Singapore for sequencing. The phylogenetic tree was constructed for the
isolates identical to A. marginale by
using MEGA 7 at maximum likelihood algorithm and with bootstrapping at 1000
replications (Fig. 4).
Statistical
analysis
Fig. 1: Map of
Pakistan showing sampling sites in targeted districts of KP
Fig. 2: Figure shows A. marginale like intracellular bodies in Giemsa’s stained thin blood smear (indicated by arrows)
Chi-square test was used to analyze the prevalence
of Anaplasma species data using SPSS
version 20. P-value < 0.05 was taken
as level of significance for the achievement of a 95% confidence interval (Farooqi
et al. 2018).
Results
Microscopically thin blood smears were
prepared and checked for the presence of intraerythrocytic inclusions bodies
resembling A. marginali (Fig. 2).
Microscopic examination showed that there were 10.00, 12.98 and 17.48% positive
cases for A. marginale infection in
cattle of Mardan, Kohat and Swat districts, respectively (Table 1). PCR showed
15.00, 16.79 and 20.28% positive cases in Mardan, Kohat and Swat districts, respectively
(Table 2). It was clear from the results that PCR is a more sensitive and
accurate method for the diagnosis of A.
marginale infection as shown by Table 3. The PCR products of A. marginale
were subjected to sequencing. BLAST and CLUSTAL W alignments were used for the
analysis of these sequences. The resulted sequenced nucleotide after BLAST
indicated the sequence similarity with the 16S ribosomal RNA gene of A. marginale.
For comparison, the nucleotide sequences of these organisms were aligned from
the NCBI database. The amplicons showed 96–99% similarity with the sequences of
nucleotide for this gene which was deposited in GenBank. Five sequence products
of A. marginale from KP with the
allotted accession numbers from NCBI i.e.,
MT893360.1 A. marginale (KP-1 Pak), MT893363.1 A. marginale (KP-2 Pak), MT893366.1 A. marginale (KP-3 Pak), MT893368.1 A. marginale (KP-4 Pak) and MT893370.1 A. marginale (KP-5 Pak) were used for
the construction of phylogenetic tree as shown by Fig. 4 (Tamura 1992; Kumar et al. 2016).
Fig. 3: PCR results for A. marginale. It shows
gel electrophoresis after PCR having clear bands of an amplified 345 base pair
DNA fragment of A. marginale against
a marker of known molecular weight of 100 base pair. The lane Ladder shows a molecular
weight marker. Positive samples of A.
marginale are shown in lane just after the lane ladder for Kohat, Mardan
and Swat districts, respectively. Lane C +ve shows control positive (A. marginale) while lane C−ve
shows control negative
Fig. 4: It shows dendrogram representing the phylogenetic locations of
genotypes of A. marginale
based on the partial sequencing of 16S ribosomal RNA gene. MT893360.1 A. marginale
(KP-1 Pak), MT893363.1
A. marginale
(KP-2 Pak), MT893366.1
A. marginale
(KP-3 Pak), MT893368.1
A. marginale
(KP-4 Pak) and MT893370.1 A. marginale (KP-5 Pak) represent the gene sequences from
this study with their allotted accession numbers from Genbank.
The published sequences of A. marginale from the Genbank
database were used in the analysis process. Ehrlichia mineirensis (CDGH01000014.1) was used as
an outgroup for this study
It was observed from the results that breed, age and sex
of cattle were non-significantly associated (P > 0.05) with A.
marginale infection among the studied districts. The district wise prevalence of infection was recorded highest in district
Swat followed by Kohat and Mardan districts, respectively. The results showed
that the rate of infection was higher in exotic breeds (Friesians and crossbred)
as compared to local breeds (Achi and Sahiwal) of cattle. The adult cattle were
affected more by the A. marginale infection as compared to young animals. Similarly, the
prevalence of infection was recorded higher in female animals as compared to males
as shown by Table 4. 10.70, 16.11, 46.70 and 26.70% were the prevalence of
infection recorded for winter, spring, summer and autumn season, respectively. It was
observed from the phylogenetic tree of A.
marginale (Fig. 4) that the sequence isolates of this study were closely
associated with each other and they showed sequence similarities with the
reported strains of USA (M60313.1, AF311303.1, AF309866.1), Thailand
(KT264188.1), Uganda (KU686774.1), Philippines (JQ839012.1, JQ839011.1), China (HM538192.1,
HM439433.1, HM538193.1), Uruguay (AF414877.1) and Zimbabwe (AF414878.1).
Multiple sequence alignment of the 16S ribosomal
RNA gene sequences of 5 different clones of A. marginale depicts
substantial variation in the genotypes of A. marginale found in different
locations of KP (Fig. 5).
Discussion
Anaplasmosis is distributed throughout the world
affecting cattle populations especially in developing countries where the
disease is highly endemic resulting in huge economic losses (Futse et al. 2003; Rodríguez et al. 2009). There is insufficient data
of tick-borne diseases especially anaplasmosis in the KP province of Pakistan,
even though livestock faces major challenges from these tick-borne diseases (Khan et al.
2004). The current study relates to the seasonal prevalence and
molecular characterization of A.
marginale in the KP province of Pakistan. The blood was screened by microscopy for A. marginale. The slides showed intraerythrocytic inclusion bodies
resembling A. marginale under a light
microscope. It correlates with the findings of Ahmad
and Hasmi (2007), Atif et al. (2012)
and Maharana et al. (2016). It
was clear from the results that polymerase chain reaction gave better results
in the identification of A. marginale
than microscopy, so it was a more accurate and sensitive method than
microscopy. It is in accordance with the findings of Khattak et al. (2012) and
Saad et al.
(2015) who confirmed PCR as a more sensitive technique for the diagnosis
of haemoparasitic infection.
The prevalence of A. marginale infection in three districts of KP was recorded by
using the Chi-Square test. It was observed that the difference in the
prevalence of infections was non-significant (P > 0.05) in the studied districts. The highest prevalence was
recorded in district Swat followed by Kohat and Mardan districts respectively.
These findings correlate with the work done by Rajput et al. (2005); Atif et al.
(2013); Farooqi et al. (2018).
The breeds of the cattle were checked
for the presence of A. marginale
infection and it was observed that the prevalence of infection was
non-significantly (P > 0.05)
associated with breeds of cattle in the studied districts. The results showed a
higher prevalence of infection in exotic breeds and their crosses as compared
to local breeds of cattle. The findings of this study are in accordance with the
studies done by Chowdhury et al. (2006); Atif et al.
(2012); Farooqi et al. (2018); Khan et al.
(2019) who have also reported a higher prevalence of Anaplasma infection
in exotic and crossbred animals as compared to local breeds of animals. This is because the exotic breeds and their crosses
are in a state of more danger to tick infestation (Bock et al. 1997).
A. marginale
infection was checked in cattle of KP province according to their age groups. It was observed that there was a non-significant (P > 0.05) association between the different age groups
of cattle and the prevalence of infection in the studied districts. The results showed a higher A.
marginale infection in adults than young cattle. Khan et al.
(2004) also reported a non-significant relationship (P > 0.05) between the prevalence of
blood parasites of bovine and age groups and they observed higher prevalence in
adults (30.76%) than young animals (23.07%) which are in accordance with this
study. Atif et
al. (2013) also reported higher anaplasmosis in adults than in young
cattle. The reason for higher
parasitic infection in adults than young animals is the higher immunity of
young animals due to the presence of foetal haemoglobin in their circulatory
blood system (Ristic and Levy 1981). On the other hand, Nazar et al. (2018) and Khan et al.
(2019) reported a higher prevalence of anaplasmosis in younger stock as
compared to adult cattle which mismatches with the results of this study.
The sex of cattle was checked against the prevalence of A. marginale infection in the study
districts. It was observed from the results that there was a non-significant (P > 0.05) association between the
prevalence of infection and sex of the cattle. It was clear from the results
that the prevalence of infection was higher in females than male cattle. This study matches
with the findings of Rajput et al. (2005) and Atif et al. (2012) who also reported higher
anaplasmosis in females than male animals in their studies. Hormonal
imbalances and immunosuppression in female animals are some of the reasons for the higher prevalence of haemoparasitic
infections in females than male animals (Kocan et al. 2003). The results of this
study showed that A. marginale
infection was prevalent in different seasons of the year in KP province of
Pakistan. Similar studies about the seasonal prevalence of anaplasmosis in KP
province were conducted by Nasreen et al. (2016) and Khan et al. (2019)
Sequencing and phylogenetic analysis of A. marginale was studied in the KP province.
It was observed from the phylogenetic tree of A. marginale (Fig. 4) that the sequence isolates of this study were
closely associated with each other and they showed sequence similarity with the
reported strains of USA, Thailand, Uganda, Philippines, China, Uruguay and Zimbabwe. Moreover, multiple sequence alignment of the 16S ribosomal RNA gene sequences of 5 different
clones of the A. marginale depicts substantial variation in the
genotypes of A. marginale found in different locations of KP (Khan et al. 2020). Liu et al. (2005); Ferrolho et al. (2016); Byaruhanga et al. (2018) have conducted similar
studies for the sequencing and phylogenetic characterization of A. marginale which correlate with this study. The importation of livestock especially
the live cattle from different regions of the world is the main reason for
sequence similarities of the local and globally found haemoparasites (Rjeibi et al. 2018).
Conclusion
Table 4: Prevalence of A. marginale infection according to breed, age and sex of
cattle
Parameter |
Mardan n(%) |
Kohat n(%) |
Swat n(%) |
Total (n%) |
Chi-square
value |
P-value |
|
District wise |
24 (15.00) |
22 (16.81) |
29 (20.30) |
75 (17.30) |
1.504 |
0.472 |
|
Breed |
Friesian |
06 (17.10) |
03 (17.60) |
08 (25.00) |
17 (20.21) |
0.728 |
0.695 |
Crossbreed |
12 (17.41) |
14 (21.90) |
12 (17.41) |
38 (18.80) |
0.576 |
.750 |
|
Achai |
06 (13.30) |
05 (12.81) |
06 (18.20) |
17 (14.51) |
0.498 |
0.780 |
|
Sahiwal |
00 |
00 |
03 (33.30) |
03 (09.70) |
8.119 |
0.017 |
|
Age |
Young |
06 (17.60) |
02 (5.91) |
06 (18.80) |
14 (14.0) |
2.836 |
0.242 |
Adult |
18 (14.30) |
20 (20.61) |
23 (20.70) |
61 (18.31) |
2.145 |
0.342 |
|
Sex |
Male |
05 (10.40) |
04 (09.31) |
04 (10.30) |
13 (10.00) |
0.035 |
0.982 |
Female |
19 (17.00) |
18 (20.51) |
25 (24.00) |
62 (20.41) |
1.662 |
0.436 |
Fig.
5: The
multiple sequence alignment of sequences of 5 clones of A. marginale viz., MT893360.1 A. marginale (KP-1 Pak), MT893363.1 A. marginale
(KP-2 Pak), MT893366.1
A. marginale
(KP-3 Pak), MT893368.1
A. marginale
(KP-4 Pak) and MT893370.1 A. marginale (KP-5 Pak) based on the partial sequencing of
16S ribosomal RNA gene. The conservation level is denoted by background shading
of the sequences “black” shows 100% conservation, the “gray with black” shows
80% conservation “grey with white” shows 60% conservation and “white” reflects
no conservation
This study concludes that A. marginale infection was most prevalent in district Swat followed by Kohat and Mardan districts of
KP province respectively. Prevalence of anaplasmosis was non-significantly (P > 0.05)
associated with districts, season, breed, age and sex of cattle. The prevalence of infection was
highest in exotic breeds and their crosses, adults and female animals. Phylogenetic analysis of A. marginale showed close sequence homology with the reported
strains of different countries of the world like USA, Thailand, Uganda,
Uruguay, Zimbabwe, Philippines and China. 5 different clones of the A. marginale found in
different locations of KP showed genetic variations in the target sequence.
Acknowledgement
The authors are thankful to all veterinary officers and
their staff for helping in the collection of blood samples.
Author Contributions
Manuscript write-up, data analysis and most of the
experiments were performed by MS. MAK and FAK helped in the collection of blood
samples from targeted districts. SHF helped in microscopy and PCR examinations
in the laboratory. RW helped at review stage of article. MIR, HA and AAS helped
in drafting of the research article and supervised the work.
Conflicts of Interest
All
other authors declare no conflicts of interest
Data
availability
Data
presented in this study will be available on fair request to the corresponding
author.
Ethics Approval
The experiments were carried
out in accordance with the guidelines issued by the Animal Ethics Committee of
University of Veterinary and Animal Sciences, Lahore, Pakistan.
References
Ahmad N, H Hashmi (2007). A comparative
study on the incidence of ticks and ticks borne diseases on local and crossbred
cattle in Malakand agency. J Anim Plant
Sci 17:56‒58
Atif FA, M Khan, T Roheen, F Muhammad,
M Younus, M Avais, S Ullah (2013). Seroprevalence of Anaplasma marginale infection among cattle from three districts of
the Northern Punjab, Pakistan. J
Anim Plant Sci 23:995‒998
Atif FA, MS Khan, HJ Iqbal, GM Arshad,
E Ashraf, S Ullah (2012). Prevalence of Anaplasma
marginale, Babesia bigemina and Theileria annulata infections among
cattle in Sargodha District, Pakistan. Afr
J Agric Res 7:3302–3307
Bock R, AD Vos, T Kingston, D McLellan
(1997). Effect of breed of cattle on innate resistance to infection with Babesia bovis, B. bigemina and Anaplasma
marginale. Aust Vet J 75:337‒340
Byaruhanga C, NE Collins, DL Knobel, ZT
Khumalo, ME Chaisi, MC Oosthuizen (2018). Molecular detection and phylogenetic
analysis of Anaplasma marginale and Anaplasma centrale amongst transhumant
cattle in north-eastern Uganda. Ticks
Tick Borne Dis 9:580‒588
d'Oliveira C, MVD Weide, MA Habela, P
Jacquiet, F Jongejan (1995). Detection of Theileria
annulata in blood samples of carrier cattle by PCR. J
Clin Microbiol 33:2665‒2669
Dumler JS, AF Barbet, C Bekker, GA Dasch, GH Palmer, SC Ray, Y Rikihisa,
FR Rurangirwa (2001). Reorganization of genera in the families Rickettsiaceae
and Anaplasmataceae in the order Rickettsiales: Unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia,
descriptions of six new species combinations and designation of Ehrlichia equi and'HGE agent'as
subjective synonyms of Ehrlichia
phagocytophila. Intl
J Syst Evol Microbiol 51:2145‒2165
El-Metenawy T (2000). Prevalence of
blood parasites among cattle at the central area of Saudi Arabia. Vet Parasitol 87:231‒236
Fanzana BM, EA Srunv (2001). A venue
based method for sampling hard-to-reach populations. Publ Health Rep 116:216‒222
Farooqi SH, M Ijaz, MI Rashid, H Nabi,
S Islam, AI Aqib, K Hussain, A Khan, SNB Rizvi, S Mahmood (2018). Molecular
epidemiology of bovine anaplasmosis in Khyber Pakhtunkhwa, Pakistan. Trop Anim Health Prod 50:1591−1598
Ferrolho J, S Antunes, AS Santos, R Velez,
L Padre, A Cabezas-Cruz, MM Santos-Silva, A Domingos (2016). Detection and
phylogenetic characterization of Theileria
spp. and Anaplasma marginale in Rhipicephalus bursa in Portugal. Ticks Tick Borne Dis 7:443−448
Futse JE, MW Ueti, DP Knowles, GH Palmer (2003).
Transmission of Anaplasma marginale
by Boophilus microplus: Retention of
vector competence Boophilus microplus:
Retention of vector competence. J Clin
Microbiol 41:3829−3834
Ghosh S, GC Bansal, SC Gupta, D Ray, MQ Khan, H Irshad,
M Shahiduzzaman, U Seitzer, JS Ahmed (2007). Status of tick distribution in
Bangladesh, India and Pakistan. Parasitol Res
101:207−216
Gubbels J, AD Vos, MVD Weide, J
Viseras, L Schouls, ED Vries, F Jongejan (1999). Simultaneous detection of
Bovine Theileria and Babesia species by reverse line blot hybridization.
J Clin
Microbiol 37:1782−1789
Iqbal N, MU Mukhtar, J Yang, MS Sajid,
Q Niu, G Guan, Z Liu, H Yin (2019). First molecular evidence of Anaplasma bovis and Anaplasma phagocytophilum in bovine from central Punjab, Pakistan. Pathogens 8:155-162
Jongejan F, G Uilenberg (2004). The global importance of
ticks. Parasitology. 129:3‒14
Jonsson N, S Reid (2000). Global
climate change and vector borne diseases. Vet J 2:87‒89
Khan M, A Zahoor, M Jahangir, MA Mirza (2004). Prevalence of
blood parasites in cattle and buffaloes. Pak
Vet J 24:193‒194
Khattak R, M Rabib, Z Khan, M Ishaq, H Hameed, A Taqddus, M Faryal, S
Durranis, Q Gillani, R Allahyar (2012). A comparison of two different
techniques for the detection of blood parasite, Theileria annulata, in cattle from two districts in Khyber Pukhtoon
Khwa Province (Pakistan). Parasite. J Soc
Franç Parasitol 19:91‒95
Kocan KM, JDL Fuente, EF Blouin, JF
Coetzee, S Ewing (2010). The natural history of Anaplasma marginale. Vet Parasitol 167:95‒107
Kocan KM, JDL Fuente, EF Blouin, JC
Garcia-García (2004). Anaplasma marginale
(Rickettsiales: Anaplasmataceae): Recent advances in dening hostpathogen
adaptations of a tick-borne rickettsia. Parasitology
129:285‒300
Kocan KM, JDL Fuente, AA Guglielmone,
RD Meléndez (2003). Antigens and alternatives for control of Anaplasma marginale infection in cattle.
Clin Microbiol
Rev 16:698‒712
Kumar S, G Stecher, K Tamura (2016).
MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger
datasets. Mol Biol Evol 33:1870‒1874
Kumar T, N Sindhu, G Charaya, A Kumar,
P Kumar, G Chandratere, D Agnihotri, R Khurana (2015). Emerging status of
anaplasmosis in cattle in Hisar. Vet
World 8:768‒771
Liu Z, M Ma, Z Wang, J Wang, Y Peng, Y
Li, G Guan, J Luo, H Yin (2012). Molecular survey and genetic identification of
Anaplasma species in goats from
central and southern China. Appl Environ Microbiol 78:464‒470
Liu Z, J Luo, Q Bai, M Ma, G Guan, H
Yin (2005). Amplification of 16S rRNA genes of Anaplasma species in China for phylogenetic analysis. Vet Microbiol 107:145‒148
Maharana B, B Kumar, A Prasad, T Patbandha, N Sudhakar, J Joseph, B Patel
(2016). Prevalence and assessment of risk factors for haemoprotozoan infections
in cattle and buffaloes of South-West Gujarat, India. Ind J Anim Res 50:733‒739
Makala LH, P Mangani, K Fujisaki, H Nagasawa
(2003). The current status of major tick borne diseases in Zambia. Vet Res 34:27‒45
Nazar M, MA Khan, AA Shah, SU Rahman, I
Khan, A Ullah, IU Khan, M Shuaib (2018). Occurrence and transplacental
transmission of Anaplasma marginale
in dairy cattle. Slov
Vet Res 55:183‒191
Nieto NC, K Khan, G Uhllah, MB Teglas
(2012). The emergence and maintenance of vector-borne diseases in the Khyber Pakhtunkhwa
province, and the federally administered tribal areas of Pakistan. Front
Physiol 3; Article 250
Rajput Z, SH Hu, A Arijo, M Habib, M
Khalid (2005). Comparative study of Anaplasma parasites in tick carrying
buffaloes and cattle. J Zhej Univ Sci B 6:1057‒1062
Ristic M, M Levy (1981). A new era of
research toward solution of bovine babesiosis (Tick control, vaccines). In: Babesiosis, pp:539‒544. M Ristic, JP Kreier (Eds.). Academic
Press Inc., New York, USA
Rjeibi MR, O Ayadi, M Rekik, M Gharbi
(2018). Molecular survey and genetic characterization of Anaplasma centrale, A.
marginale and A. bovis in cattle
from Algeria. Transb Emerg Dis 65:456‒464
Rodríguez SD, MÁG Ortiz, RJ Ocampo, YCAV Murguía (2009).
Molecular epidemiology of bovine anaplasmosis with a particular focus in
Mexico. Infect Genet Evol
9:1092–1101
Roy B, J Krücken, J Ahmed, S Majumder,
M Baumann, PH Clausen, A Nijhof (2018). Molecular identification of tick‐borne pathogens infecting cattle in
Mymensingh district of Bangladesh reveals emerging species of Anaplasma and Babesia. Transb Emerg Dis
65:231‒242.
Saad F, M Khaisroon, K Khan, NU Akbar (2015). Prevalence and Molecular
Detection of Babesiosis in the Slaughter Animals of Peshawar Khyber Pakhunkhawa
Pakistan. Intl J Curr Microbiol Appl Sci
4:1030‒1036
Shah S, M Khan, H Rahman (2017).
Epidemiological and hematological investigations of tick-borne diseases in
small ruminants in Peshawar and Khyber agency, Pakistan. J Adv Parasitol 4:15‒22
Tamura K (1992). Estimation of the number of nucleotide substitutions when
there are strong transition-transversion and G+ C-content biases. Mol Biol Evol 9:678‒687
Tay S, F Koh, K Kho, B Ong (2014).
Molecular survey and sequence analysis of Anaplasma
spp. in cattle and ticks in a Malaysian farm. Trop Biomed 31:769‒776
Thrusfield M (2007). Veterinary
Epidemiology, 3rd Edition, pp:231‒232.
Blackwell Science, London, UK
Turi A, A Rahman, I Ali, SA Rafiullah,
K Khan, I Shah, M Gondal, A Rashid, S Ahmed, X Wang, R Khan, SHA Raza, A Li, Y
Zhang, C Liang, W Yang, S Wu, L Zan (2019). Molecular characterization of ABHD5 gene promoter in intramuscular
preadipocytes of Qinchuan cattle: Roles of Evi1 and C/EBPα. Gene 690:38‒47